Looking for matlab programmer jobs

Filtro

Minhas pesquisas recentes
Filtrar por:
Orçamento
para
para
para
Tipo
Habilidades
Idiomas
    Estado do Trabalho
    105 looking for matlab programmer trabalhos encontrados, preços em USD

    Looking for programmer who is able to program in Matlab. Able to do customize coding for Neural Network and maybe other toolbox as well. Electrical engineering background is preferred.

    $4476 (Avg Bid)
    $4476 Média
    9 ofertas

    Looking for programmer who is able to program in Matlab. Able to do customize coding for Neural Network

    $3963 (Avg Bid)
    $3963 Média
    9 ofertas

    I am a university-based researcher looking for a programmer to develop a web-based task from a cognitive task that has already been coded in matlab or eprime. The tasks are pretty straightforward involving measurements of reaction times or choice. I would pay per task but there is the opportunity for development of several tasks or to develop these

    $705 (Avg Bid)
    $705 Média
    20 ofertas

    Preferably looking for someone with NXT lego programming experience as it may be quicker to understand but should be relatively simple regardless The task required is relatively simple Matlab programming to control a 2 motor lego NXT mindstorms robot. The task of the robot is to draw as straight as possible lines between given coordinate points

    $11 (Avg Bid)
    $11 Média
    2 ofertas

    Looking for matlab developer to write a code to reconstruct or reassemble images. All the details will be provided.

    $182 (Avg Bid)
    $182 Média
    5 ofertas

    Hi, I am working on a project and I need a expertise matlab-simulink programmer. I need a real time simulation model, I have created a some code(.m and .slx file) but I need it to convert it into real time silulink model. The main part is to plant model in simulink. Hardware contains PZT bending actuators(BA4510), Piezo driver (PDu100) and Parallel

    $153 (Avg Bid)
    $153 Média
    1 ofertas
    simulink modeling Encerrado left

    Hi, I am working on a project and I need a expertise matlab-simulink programmer. I need a real time simulation model, I have created a some code(.m and .slx file) but I need it to convert it into real time silulink model. The main part is to plant model in simulink. Hardware contains PZT bending actuators(BA4510), Piezo driver (PDu100) and Parallel

    $153 (Avg Bid)
    $153 Média
    1 ofertas

    Hi, I am working on a project and I need a expertise matlab-simulink programmer. I need a real time simulation model, I have created a some code(.m and .slx file) but I need it to convert it into real time silulink model. The main part is to plant model in simulink. Hardware contains PZT bending actuators(BA4510), Piezo driver (PDu100) and Parallel

    $154 - $154
    $154 - $154
    0 ofertas

    I am looking for a matlab programmer to implement Optimal Under Frequency LoadShedding. I have complete details with me, which i can share with you. Please get back to me asap

    $144 (Avg Bid)
    $144 Média
    11 ofertas

    I am looking for a matlab programmer to implement Optimal Under Frequency LoadShedding. I have complete details with me, which i can share with you. Please get back to me asap

    $30 - $250
    Secreto
    $30 - $250
    11 ofertas

    If you are a good MATLAB programmer, then this project is for you. Ideally we are looking for individuals who have top-notch MATLAB programming skills. The individual should be able to come on Skype for the discussion once the project is awarded. Since we are a time sensitive group, we don't want anyone to waste our time. You should be able...

    $184 (Avg Bid)
    $184 Média
    22 ofertas

    I am looking for a Professional Programmer who will teach/tutor me how to do the following: 1) How to use a Matlab Compiler to produce DLLs for functions built in Matlab. 2) How to build an API that will make it easy for me to call functions compiled in the generated Matlab DLL into any of programming language MQL4,MQL5, Java and C#.

    $2 - $8 / hr
    Destacado
    $2 - $8 / hr
    0 ofertas

    I am looking for a Professional Programmer who will teach/tutor me how to do the following: 1) How to use a Matlab Compiler to produce DLLs for functions built in Matlab. 2) How to build an API that will make it easy for me to call functions compiled in the generated Matlab DLL into MQL4+MQL5+Java+C#.

    $25 / hr (Avg Bid)
    Destacado
    $25 / hr Média
    3 ofertas
    Matlab Small Project Encerrado left

    I am looking for a matlab programmer to program a small application for me. This will calculate surface area and perimeter of an irregular object using GUI. I need it basic with commented code. I have complete details which i can share with interested bidders.

    $105 (Avg Bid)
    $105 Média
    11 ofertas

    Hi , We are an India based Outsourcing Company programming for US based University students for their MATLAB [login to view URL] Programs have already been developed but there are certain errors causing the incorrect results. We are essentially looking for a skilled MATLAB programmer ( knowledge in Electronics , a welcome) who can rectify such err...

    $154 (Avg Bid)
    $154 Média
    1 ofertas

    ...script [login to view URL] heres what we need done 1. we would like to be able to create a test using something like this [login to view URL] or anything else you think may work to accomplish the overall goal see below the admin will upload a image via admin panel will be able

    $633 (Avg Bid)
    $633 Média
    6 ofertas

    ...forwarded to you by "stepstosuccess". We are looking for a programmer who has sound knowledge in Matlab and MAthematics. We basically have want a programmer who can complete a project about A GUI that allows parameter identification of a simple respiratory mechanics model. We belive that if programmer has good skills then it can be completed ...

    $80 (Avg Bid)
    $80 Média
    1 ofertas

    Hello, We are looking for a programmer having sound knowledge in matlab coding and maths. Our project deals with Graphical user interface and if the programmer has good knowledge than it can completed within 2 hours. There are basically 4 task from which one is done so only three are to be done. If you think you are interested in it and then do let

    $80 - $80
    $80 - $80
    0 ofertas

    Hello, We are looking for a programmer having sound knowledge in matlab coding and maths. Our project deals with Graphical user interface and if the programmer has good knowledge than it can completed within 4 hours. There are basically 4 task from which one is done so only three are to be done. If you think you are interested in it and then do let

    $40 (Avg Bid)
    $40 Média
    1 ofertas

    Hello, We are looking for a programmer has good skills in mathematics and matlab. We are in need of urgent help. There are basically 4 task from which one is done and only 3 more to do. We belive that if programmer has good skills than he can do it within 4 hours. If you think you can do it then we shall further discuss about the project and I can

    $50 (Avg Bid)
    $50 Média
    1 ofertas

    Hello, We are looking for a programmer who has good skils in Matlab. Do you take in projects which has to deal with Guided user interface in Matlab ? If the project is understood then we belive it only requires 4 hours to do it and we dont want any professional work as we are students. Our only condition is program should be working and must have accurate

    $50 - $50
    $50 - $50
    0 ofertas
    Matlab Programming Encerrado left

    Hi , We are an India based Outsourcing Company programming for US based University students for their MATLAB [login to view URL] Programs have already been developed but there are certain errors causing the incorrect results. We are essentially looking for a skilled MATLAB programmer ( knowledge in Electronics , a welcome) who can rectify such...

    $624 (Avg Bid)
    $624 Média
    31 ofertas

    I'm looking for a freelance programmer who able to create an optimization programming with MATLAB for: 1. PID optimization with Ziegler Nichols for the water level control 2. PSO-PID optimizaation for water level control using MATLAB I'm looking for a person that could complete this project in short time.. TQ

    $576 (Avg Bid)
    $576 Média
    12 ofertas
    Matlab Programming Encerrado left

    Hi , We are an India based Outsourcing Company programming for US based University students for their MATLAB [login to view URL] Programs have already been developed but there are certain errors causing the incorrect results. We are essentially looking for a skilled MATLAB programmer ( knowledge in Electronics , a welcome) who can rectify such...

    $407 (Avg Bid)
    $407 Média
    13 ofertas

    Looking for a programmer proficient in Matlab who can use the Psychtoolbox extension (freely available) to create four simple games from existing detailed mock-ups. Each game is a simple behavioral test to be used for psychology research. Mock-ups include both sketches of each screen and detailed descriptions of game flow and suggested data structures

    $585 (Avg Bid)
    $585 Média
    8 ofertas

    ...proficient in the R programming language to help design simulations and develop flexible R scripts/functions implementing methods in published statistical literature. i'm ideally looking for someone with a background in statistics/mathematics, but people in econometrics, computer sciences, etc. area also welcome. ideally this would be a series of projects, about

    $828 (Avg Bid)
    Destacado Urgente
    $828 Média
    14 ofertas

    I need a a software for genome assembly based on an algorithm of mine. In genome assembly the software is given millions of strings (reads) and merges two strings based on some detected overlap between them. For example: AAGTTAAATGAGA and GTTCCCAAGTTAA will merge into: GTTCCCAAGTTAAAAGTTAAATGAGA because AAGTTAA is a an overlapping string between

    $1270 (Avg Bid)
    $1270 Média
    20 ofertas

    We are looking for a quant and programmer who can help us develop a financial application to analyze cointegration between price series. Coders must have: - Extensive experience with analysis, stochastic calculus for finance, regression analysis, computational finance, numerical solution of partial differential equations, applied time series analysis

    $15 / hr (Avg Bid)
    $15 / hr Média
    10 ofertas

    I need to implement my idea to enhance greedy forwarding scheme for position based routing in MANET. I am looking for a c++ programmer, matlab and NS2 experts to implement my work and extract convincing results. All partial and finalized codes with results of implementation are in need to be completed in a full report to me. I will provide further details

    $1290 (Avg Bid)
    $1290 Média
    5 ofertas

    We're looking for a quant programmer to build a fairly basic application (Java preferable, C# okay) that will download stock data from Yahoo or Google for a list of stocks and calculate the cointegration between pairs of all the symbols using Augmented Dickey-Fuller and Johansen Test and simulate a backtest for each pair based on deviations from the

    $1351 (Avg Bid)
    $1351 Média
    9 ofertas
    Matlab Programming Encerrado left

    Hi , We are an India based Outsourcing Company programming for US based University students for their MATLAB [login to view URL] Programs have already been developed but there are certain errors causing the incorrect results. We are essentially looking for a skilled MATLAB programmer ( knowledge in Electronics , a welcome) who can rectify such...

    $470 (Avg Bid)
    $470 Média
    26 ofertas
    Matlab Project Encerrado left

    Hi !! I am looking for an outstanding matlab programmer to complete various assignment and final projects (college/university level problems)for me with short deadlines. I will provide complete details after i will have bids. Once we will agree on price and time you can adjust bid accordingly and i will first give a single task. I had bad experience

    $166 (Avg Bid)
    $166 Média
    11 ofertas
    matlab simulation Encerrado left

    I am looking for some good matlab programmer who can do this task for me. [login to view URL] looking for low price and less time frame NOTE : matlab coding is done with me, I just need simulation and documentation.

    $138 (Avg Bid)
    $138 Média
    4 ofertas

    ...curve. These are around 20 points, for which there will be multiple variables. The variables consist of profit/loss, yield, delta, and vega. The program will minimize certain values, at certain points, while optimizing other values at other specific points. Skills: The project requires a seasoned C# developer, with MatLab and optimization experience. Further

    $1875 (Avg Bid)
    $1875 Média
    15 ofertas

    ...someone with experience in Matlab programming to download historical stock data for me and set up a demo Matlab program which scans the NASDAQ historical stock prices and identifies stocks that satisfy certain test criteria. [I can program in Matlab myself--at least, to a modest level--and I want to play around using Matlab code to do stock market

    $66 (Avg Bid)
    $66 Média
    6 ofertas

    I am looking for some good matlab programmer who can do this task for me. [login to view URL] looking for low price and less time frame

    $232 (Avg Bid)
    $232 Média
    7 ofertas

    Por favor, Cadastre-se ou Faça Login para ver os detalhes.

    Destacado

    ...assistance to create program for data analysis on Matlab Project (Simulink). Immediate Urgent Project submission. I would like to need guidance from Matlab Programmer to finish the project about Fiber Communication Network. It should be simple simulations (with block diagrams or coding) to perform the results. Looking for programmers that hav...

    $265 (Avg Bid)
    $265 Média
    16 ofertas

    This project is for the ultrasound image processing using matlab. We are looking for the very high qualified programmer. Thank you.

    $596 (Avg Bid)
    $596 Média
    41 ofertas

    I am looking for some good matlab programmer who can do this task for me. [login to view URL] looking for low price and less time frame

    $129 (Avg Bid)
    $129 Média
    7 ofertas

    ...to write to this list. I'm looking for a programmer for an open source web project called Speedy Composer - a program that will automatically compose music. This is a project I did a few years ago, which can compose melodies using MATLAB - using artificial neural networks. I need a programmer who can convert this MATLAB code into web inte...

    $950 (Avg Bid)
    $950 Média
    7 ofertas

    Por favor, Cadastre-se ou Faça Login para ver os detalhes.

    Destacado Secreto
    C++ Matlab Interface Encerrado left

    ...and are looking for a programmer to write an interface between a Matlab project and a trading software. The interface should be written in C++. The API is provided and the project is done in different stages. The first stage is to get trading software data feed into Matlab. This is quite straight forward. IF we are happy with the programmer, they

    $291 (Avg Bid)
    $291 Média
    19 ofertas

    ...pretty basic matlab program that is written inefficiently and I need it to run more quickly. The inefficient sections mostly contain matrix manipulation. The entire program is about 1500 lines. I am looking for a very careful programmer who is comfortable working with matrix algebra in Matlab. I will send you the program and ask for specific pro...

    $100 (Avg Bid)
    $100 Média
    1 ofertas

    I am looking for a programmer who can develop a script to perform cointegration (ADF & CADF) tests in Matlab. I will provide the programmer with the sample data so that he/she can test the script. The programmer should have some exposure to financial industry. I have a sample script which I can provide to have a better understanding.

    $50 (Avg Bid)
    $50 Média
    1 ofertas

    ...Black Litterman/ Optimizer add-in - needs to be a webbased with database integrated application and multi-user protected enabled - open for solution-orientated proposals. Looking for a quantitative programmer (matlab skills) that has also a strong financial know-how background (experience in Black-Litterman, Optimization, Tracking error etc. is a must)

    $1959 (Avg Bid)
    Destacado
    $1959 Média
    15 ofertas

    ...add and modify for improving the existing code written in Matlab to extract a number of attributes from a set of worm under the microscope images. The images are frames extracted from 10 second videos. The existing code places bounding boxes and an arbitrary filter on the background. It preprocesses the images and extracts attributes for each worm. Inside

    $471 (Avg Bid)
    $471 Média
    12 ofertas