Perl php text database jobs

Filtro

Minhas pesquisas recentes
Filtrar por:
Orçamento
para
para
para
Habilidades
Idiomas
    Estado do Trabalho
    7,444 perl php text database trabalhos encontrados, preços em USD

    ...need a database with a web interface where all fields can be searched by customers, returned and sorted in html. We also need an html interface where our employees can create records. We will need to add and retrieve records through text boxes and drop down boxes. Some sorting options will be required. I would like this to be set up with MySQL. PHP or perl

    PHP
    $212 (Avg Bid)
    $212 Média
    2 ofertas
    Perl CGI Projects Encerrado left

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    a script in either php or perl with mysql that's a clone of [login to view URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    $1640 (Avg Bid)
    $1640 Média
    5 ofertas

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The mysql file is already in use and this script...

    $68 (Avg Bid)
    $68 Média
    5 ofertas
    PERL SCRIPT TWEAKS Encerrado left

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    $21 (Avg Bid)
    $21 Média
    2 ofertas

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    $144 (Avg Bid)
    $144 Média
    4 ofertas
    Newsletter Manager Encerrado left

    I need a PHP script with MySQL backend to manage and maintain a newsletter for a website. Full documentation of database structure and user interface will be provided. Complete specifications have already been documented, all you will need to do is implement them in code. I need all script variables (database info, etc) to be maintained in a config

    $357 (Avg Bid)
    $357 Média
    24 ofertas
    P2P Network Encerrado left

    ...clients and all the clients form a network. You may keep a list of currently online clients in a txt file on a web server, but that's it. You can access this text file by either FTP or running a PHP or Perl script (which you must provide). I'd like the txt file to be secure though. All the connections are done directly between clients and not through the server

    $85 (Avg Bid)
    $85 Média
    1 ofertas

    I have a perl script that I bought (Over a year ago.) to do a thumbnail gallery and included in the program was a picture thumbnailer. I need to get the picture thumbnailer setup as a separate program that I can use on other websites. What it does? I place any number of full sized pictures into a folder on the server. The cgi script goes out and grabs

    $25 (Avg Bid)
    $25 Média
    1 ofertas

    ...conversion of two C programs into two Perl based CGI scripts which will be invoked by either the HTTP “get” or “post” method. The C programs have two or so other C programs (and a header file) that they are dependant on. A number of the functions in these supporting C programs also need to converted into the appropriate Perl functions/modules to provide exactly

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas
    Perl Upload.cgi Encerrado left

    Need to transfer a unix - script to an win2000 machine. It`s an upload script. ## Deliverables The script must be checked - and then changed to work on a win2000 server. 1 function must be removed from the script. Please contact me for a copy of the file. ## Deadline information Only 320 lines of code for review. i think for an professional should be 10 min. work.

    $87 (Avg Bid)
    $87 Média
    8 ofertas
    Perl Trainer Wanted Encerrado left

    Possible week long training in London. Please e-mail with day rates etc.

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    Wanted hardcore serious experieced PERL programmers who should possess good OOP knowledge. Preference would be given to the people familiar with some of the important PERL modules. CGI programming knowledge is a plus. Contact without CV mentioning total years of experience and nationality. Location is UK/EU. Foreign nationals [login to view URL] azsx109@onebox

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    We require a freelance programmer to make small modifications to an ‘off the shelf’ perl script. Working remotely, in your own time our requirements are as follows: 1. Once the customer has placed the product(s) in to the basket, the final page, which collects the customer information, will be located on a remote secure server ([login to view URL]) We

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    [login to view URL]

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    Hi, I need a perl cgi script made. Basically, the perl script will verify a list of email addresses, and save the valid ones to a text file. I have found a perl module at [login to view URL] that I think does this. What I am wanting is for someone to take this module, or make their own, and provide to me a fully-functioning script, ready

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas
    Perl Development Encerrado left

    We need to have a script built that will take information supplied in a form and then build a HTML page automatically into the correct directory structure on our servers. Would be interested in hearing from anyone that thinks they can do this. I very good example is NetCard located at [login to view URL]

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    We are looking for a "low cost" CGI/Perl programmer to do two projects which may involve hacking existing scripts. Our budget is very limited, however, we are prepared to off-set the difference with advertising on our site including free job/project referrals. [login to view URL] will soon begin helping businesses and individuals find, compare and select web

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas
    PHP/Perl Developer Encerrado left

    ...small to large company Web Sites, due to expansion are seeking an experienced Lead/Senior Programmer to compliment our existing team. 2 x Perl, PHP, MYSQL developers with experience for programming for database dynamic driven E-commerce Web Sites. One more senior 3 years + and one junior with System Administration on Linux and NT. Were looking for

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas

    Hi We have a requirement for a perl contrator to do some 'polishing' to existing code and to create some new modules. This person needs to based in the UK, either in Hampshire or Berkshire. The following skills are ideal: Perl, Unix, CGI Please drop me a mail or call for a chat on: 01256 411344 07989 140124 Thanks! Mark Hughes [login to view URL]

    $200 - $300
    Secreto
    $200 - $300
    0 ofertas